eddb.pl

Dariusz W. Szczepanik1,2

1  Department of Theoretical Chemistry, Jagiellonian University
    Faculty of Chemistry, Gronostajowa 2, 30-387 Krakow, Poland
2  Institute of Computational Chemistry and Catalysis, University of Girona
    C/ Maria Aurèlia Capmany, 69, 17003 Girona, Catalonia, Spain



PL  What is EDDB?

The Electron Density of Delocalized Bonds (EDDB) enables one to visualize and quantify chemical resonance, multicenter bonding and aromaticity in a wide range of chemical species. It relies on the following decomposition scheme:


The RunEDDB program is an R-based implementation of the EDDB method, and its current version (19.01) works with Gaussian formatted checkpoint files for the following computational methods (closed- and open-shell systems): HF, DFT, MP2, MP3, MP4(SDQ), QCISD, CCD, CCSD, CID, CISD, BD, CIS, TD and SAC-CI. It involves the Hilbert-space partitioning within the representation of natural atomic orbitals (NAO), which is widely available for most of the popular quantum-chemistry packages through NBO and JaNPA interfaces.

PL  Examples


Global resonance effects in DNA fragment AATTCGTATAAAAACTAGAC visualized by EDDBg(r):

PL  Download







Last update:    2018-01-09